Student Solution

-->

"Education is the most powerful weapon which you can use to change the world”
– Nelson Mandela

1 University

1 Course

2 Subjects

Download Solution

Related Solution

Unit 4 Assignment Sp...
There had been the motive of making it possible for human beings to be able to live in the planet Mars in future by Elon Musk (Hill et al., 2020). That is why there had also been the motive shown by h...

Unit 4 Assignment SpaceX
Unit 4 Assignment SpaceX

There had been the motive of making it possible fo

Module 1 Discussion...
For the first biblical story, I chose Genesis 12:1-5a. • Abraham was called upon by God to depart his country for Canaan. God promised that he and Sarah would bear a child if they fulfilled his comman...

Module 1 Discussion 2
Module 1 Discussion 2

For the first biblical story, I chose Genesis 12:1

Week 3 Discusssion 2...
Getting Started in Thinking About the Briefing Paper Assignment: The last writing assignment in our class will be a briefing paper. This discussion thread is designed to help you get started in thinki...

Week 3 Discusssion 2
Week 3 Discusssion 2

Getting Started in Thinking About the Briefing Pap

Critical Thinking 4 Chapters 6,9-10

Critical Thinking 4 Chapters 6,9-10

Q 1. The sequence above is DNA. (5 points) a. What is the complimentary DNA strand? b. What is the mRNA strand? Use your DNA 3’-5’ strand as the templatec. What is the amino acid sequence? d. What is the result of a mutation in the 6th C to a G (blue arrow)? Name of mutation and any changes to the amino acid.e. What is the result of a mutation in the 3rd T to a A? Name of mutation and any changes to the amino acid sequence.

View Related Questions

Solution Preview

View Complete Solution
3’ GGTTCCGTACGATATATTATTGG 5’ mRNA is SS molecule that carries information from DNA and carry it further to make proteins. For DNA 3’-5’, mRNA will be CCAAGGCAUGCUAUAUAAUAACCPro-Arg-His-Ala-Ile-Ile-ThrThis change will change the sequence of amino acid replacing Alanine with Glycine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.This change will change the sequence of amino acid replacing isoleucine with Lysine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.